Cyfroteka.pl

klikaj i czytaj online

Cyfro
Czytomierz
00068 006364 18984008 na godz. na dobę w sumie
Katania, Syrakuzy i Taormina. Michelin. Wydanie 1 - książka
Katania, Syrakuzy i Taormina. Michelin. Wydanie 1 - książka
Autor: Liczba stron: 136
Wydawca: Bezdroża Język publikacji: polski
ISBN: 978-83-283-4334-4 Data wydania:
Lektor:
Kategoria: ebooki >> przewodniki >> przewodniki turystyczne po kontynentach i regionach
Porównaj ceny (książka, ebook (-35%), audiobook).

Choć w Katanii trudno zakochać się od pierwszego wejrzenia, drugie co do wielkości miasto Sycylii przyciąga wyjątkową energią i młodzieńczą atmosferą.

Katania jest nierozerwalnie związana z Etną, nie tylko ze względu na górującą nad miastem majestatyczną sylwetkę wulkanu, ale także wszechobecną skałę wulkaniczną, z której wzniesiono zachwycające kościoły i pałace. Wyjątkowemu dziedzictwu architektonicznemu Katania zawdzięcza nie tylko niezwykły urok, ale również wpis na listę światowego dziedzictwa kulturowego i przyrodniczego UNESCO.

Miłośnicy baroku, których zwiedzanie Katanii zachęci do dalszej podróży, powinni wybrać się do Syrakuz, Ragusy i Noto, aby odkryć architekturę tak piękną, że bardziej przypomina teatralną scenografię niż realne miasto. Natomiast ci, których zmęczy zgiełk metropolii, mogą odpocząć na jednej z plaż w niedalekiej Taorminie.

Ruszaj w świat z przewodnikiem Michelin!

Michelin zaprasza Cię do wspólnego odkrywania najpiękniejszych zakątków Sycylii. Z tym przewodnikiem zwiedzanie będzie prawdziwą przyjemnością!

Dokładne plany ułatwią swobodne poruszanie się po mieście. Szukasz ciekawych miejsc, zabytków i tras zwiedzania? Nic prostszego! Dzięki gwiazdkom przy nazwach dzielnic i obiektów nie pominiesz żadnej turystycznej atrakcji. Starannie dobrane informacje praktyczne pomogą Ci znaleźć nocleg, restaurację czy kawiarnię, w których spędzisz wyjątkowe chwile.

Gwiazdki - tradycyjny system oceny atrakcji turystycznych:

*** zobacz koniecznie

** warto odwiedzić

* godne uwagi

Znajdź podobne książki Ostatnio czytane w tej kategorii

Darmowy fragment publikacji:

KATANIA, SYRAKUZY I TAORMINA Tytuł: Katania, Syrakuzy i Taormina. Michelin Teksty: Catane, Taormine Syracuse. Week-end Tłumaczenie: AD LITTERAM Justyna Nowakowska Redaktor prowadzący: Agnieszka Krawczyk Redakcja: Anna Palonek Korekta: Małgorzata Kotarba Projekt graficzny: Dawid Kwoka Skład i fotoedycja: Sabina Binek Projekt okładki: Jan Paluch Zdjęcie na okładce: Andreas Zerndl / Shutterstock.com Wszelkie prawa zastrzeżone. Nieautoryzowane rozpowszechnianie całości lub fragmentu niniejszej publikacji w jakiejkolwiek postaci jest zabronione. Wykonywanie kopii metodą kserograficzną, fotogra- ficzną, a także kopiowanie książki na nośniku filmowym, magnetycznym lub innym powoduje narusze- nie praw autorskich niniejszej publikacji. Wszystkie znaki występujące w tekście są zastrzeżonymi znakami firmowymi bądź towarowymi ich właścicieli. Autor oraz wydawnictwo Helion dołożyli wszelkich starań, by zawarte w tej książce informacje były kompletne i rzetelne. Nie biorą jednak żadnej odpowiedzialności ani za ich wykorzystanie, ani za związane z tym ewentualne naruszenie praw patentowych lub autorskich. Autor oraz wydawnictwo Helion nie ponoszą również żadnej odpowiedzialności za ewentualne szkody wynikłe z wykorzystania informacji zawartych w książce. Wydawnictwo Helion ul. Kościuszki c, - Gliwice tel.:     e-mail: redakcja@bezdroza.pl Księgarnia internetowa: http://bezdroza.pl Drogi Czytelniku! Jeżeli chcesz ocenić tę książkę, zajrzyj pod adres: http://bezdroza.pl/user/opinie/?beetm1 Możesz tam wpisać swoje uwagi, spostrzeżenia, recenzję. Wydanie I ISBN: 978-83-283-4334-4 Copyright © Le Guide Vert Michelin – Michelin cie MICHELIN TRAVELPARTNER, 27 cours de l’île Seguin - 92100 Boulogne-Billancourt Copyright © for the Polish Edition by Helion, 2018 • Kup książkę • Poleć książkę • Oceń książkę • Księgarnia internetowa • Lubię to! Nasza społeczność Kup książkę Poleć książkę KATANIA, SYRAKUZY I TAORMINA© majonit / Fotolia.com KATANIA I TAORMINA W TRZY DNI DZIEŃ PIERWSZY RANO Pierwszy dzień warto rozpocząć od zanurzenia się w atmosferze miasta, czyli wyprawy na targ rybny« (s. 83) na piazza Alonzo di Benedetto. Po space- rze można wyruszyć na starówkę, której wizytówką jest dostojny piazza del Duomo«« (s. 80) słynący z barokowych budowli, Fontana dell’Elefante« (s. 80) i katedra«« (s. 81). m o c a . i l o t o F / i d n a r g o g e d © i Piazza del Duomo w Katanii W POŁUDNIE Obiad z rybą w roli głównej w Osteria Antica Marina (s. 36), w pobliżu targu. PO POŁUDNIU Dalsze zwiedzanie starówki, kościoła San Benedetto«« (s. 86) i Monastero dei Benedet- tini«« (s. 87). Powrót na piazza del Duomo i spacer do Badia di Sant’Agata« (s. 84) i Palazzo Biscari«« (s. 84), który można zwiedzać po wcześniejszej rezerwacji. Podzi- wianie wystaw sklepów ciągnących się wzdłuż via Etnea« (s. 90). WIECZOREM Dzień warto zakończyć w Wine bar Razmataz (s. 36), znajdującym się na niewielkim, urokliwym placu. DZIEŃ DRUGI RANO Grzechem byłoby przyjechać do Katanii i nie wybrać się na jedno ze zboczy Etny««« (s. 93), wulkan jest bowiem nieodłączną częścią dziedzictwa tych tere- nów. Warto założyć wygodne buty i kurtkę chroniącą przed wiatrem, ponieważ śmiałków czeka wspinaczka na wysokość 2700 m n.p.m.! Szlak, który bierze początek przy schronisku Rifugio Sapienza (s. 95), gdzie można dotrzeć, jadąc kolejką linową lub samochodem terenowym, wije się pośród kraterów i zastygłej lawy. Przejście trasy zajmuje 2 godz. Niezapomniane wrażenia! Kup książkę 10 Poleć książkę W POŁUDNIE Oprócz krajobrazów Etna ma do zaofe- rowania... wina, które są świadectwem jej osobliwego piękna. Obiad warto zjeść w Rifugio Sapienza (s. 37), gdzie serwowane są lokalne potrawy. PO POŁUDNIU Idealnym przystankiem w podróży będzie Acireale« (s. 94), miejscowość położona nad brzegiem morza, której serce bije na piazza del Duomo««. Warto wybrać się do Villa Belvedere, na krańcu Corso Umberto I, skąd roztacza się wspaniały widok. m o c a . i l o t o F / n w o r B d v a D © i Piazza del Duomo w Acireale WIECZOREM Gelato lub aperitivo w kawiarni Cipriani (s. 42), a potem powrót do Katanii lub przejazd do Taorminy. DZIEŃ TRZECI RANO Zwiedzanie Taorminy««« (s. 97), w tym Teatro Greco««« (s. 99), skąd można podziwiać wyjątkowy widok na Etnę i morze. Spacer wykutymi w skale stopniami widowni jest najlepszym sposobem na obejrzenie teatru. Zwiedzanie miasta i prze- chadzka corso Umberto I« (s. 98), wypełnioną sklepami i kawiarniami. POŁUDNIE Chwila przerwy w popularnym Mocambo Bar (s. 43) na urokliwym piazza IX Aprile«« (s. 101). PO POŁUDNIU Przejazd do Castelmoli« (s. 103), niedaleko Taorminy. Z piazza Sant’Antonio można podziwiać panoramę« okolicy, rozciągającą się od Etny aż po plaże u stóp Taorminy. Spacer stromymi uliczkami i odpoczynek w Antico Caffè San Giorgio (s. 43), gdzie można skosztować miejscowego specjału – wina migdałowego blandanino. m o c a . i l o t o F / V a s i n e D © Kościół San Giuseppe w Taorminie Kup książkę 11 Poleć książkę Kup książkę Poleć książkę SYRAKUZY I OKOLICE W TRZY DNIDZIEŃ PIERWSZYRANORozpoczynamy zwiedzanie Syrakuz od Ortygii««« (s. 105), która zachwyca niemal wyspiarskim spokojem. Na uwagę zasługują: piazza del Duomo«« (s. 106), przy któ-rym wznosi się katedra««, barokowe pałace i piękny kościół Santa Lucia alla Badia« (s. 107). Zwiedzając świątynię, można podziwiać słynny obraz Caravaggia. Warto zatrzymać się na cappuccino w ogródku letnim kawiarni Condorelli (s. 44).W POŁUDNIEPo szybkim obiedzie w Cala Piada (s. 39) warto przespacerować się nadmorską pro-menadą lungomare i okolicznymi uliczkami.PO POŁUDNIUPrzed skwarem można skryć się w Galleria Regionale di Palazzo Bellomo« (s. 109), gdzie odkryjemy sztukę sycylijską i odpoczniemy na pięknym wewnętrznym dziedzińcu. Do centrum wrócimy, idąc via Roma (s. 110), jedną z najbardziej gwarnych ulic w mieście, lub via della Maestranza« (s. 110), najstarszą ulicą w Syrakuzach, przy której wznoszą się barokowe pałace.WIECZOREMDoskonałym zakończeniem dnia będzie kolacja w słynnej restauracji Don Camillo (s. 40), w której serwowane są dania z ryb.DZIEŃ DRUGIRANOPrzedpołudnie warto przeznaczyć na zwiedzanie antycznej części Syrakuz i Parku archeologicznego Neapolis««« (s. 112). W mieście nie brakuje śladów greckiej prze-szłości, ale najlepiej zachowanym zabytkiem jest Teatro Greco««« (s. 113), jedna z największych antycznych budowli w całości wykutych w skale. Niezwykłe Lato-mie«« (s. 114), dawne kamieniołomy, w starożytności pełniły funkcję więzienia. Na szczególną uwagę zasługuje intrygujące Orecchio di Dionisio««« (s. 114).© Fabio Federico / Dreamstime.comOrtygia12 m o c a . i l l o t o F / e y b m o b © Zabudowania Ragusy W POŁUDNIE W najgorętszej porze dnia warto wybrać się do Noto«« (s. 120). Zaraz po przyjeź- dzie można skusić się na lody lub słodkie wypieki w Caffè Sicilia (s. 45) przy corso Vitto- rio Emanuele III«« (s. 120). PO POŁUDNIU Nie wiadomo, jak dziś wyglądałoby Noto, gdyby w 1693 r. nie doszło do tragedii. Zamiast dywagować, warto podziwiać barokowe budowle, które powstały na gru- zach miasta zniszczonego w wyniku trzęsienia ziemi. Noto zachwyca pięknem archi- tektury – od kościoła San Francesco all’Immacolata, przez Palazzo Ducezio, po katedrę San Nicolò«« (s. 121, 122). WIECZOREM Anche gli Angeli (s. 44) spełni oczekiwania miłośników dobrego wina. DZIEŃ TRZECI RANO Wyjazd do Ragusy«« (s. 124), barokowego klejnotu, który spotkał tragiczny los podobny do Noto. Na uwagę zasługuje labirynt uliczek Ragusy Ibli i katedra San Gior- gio«« (s. 126). W POŁUDNIE Przed wyjazdem można wybrać się na obiad do restauracji Ai Lumi (s. 41). PO POŁUDNIU Postój w Modice« (s. 129), która ucierpiała w wyniku trzęsienia ziemi i powodzi na początku lat 20. XX w. Dwie części miasta, górna i dolna, są połączone schodami. Zwiedzanie warto rozpocząć od katedry San Giorgio«« (s. 129), potem miłośnicy słodkości mogą skierować kroki do Palazzo della Cultura (s. 130), w którym mieści się Muzeum Czekolady, uznawanej za miejscowy specjał. WIECZOREM Locanda del Colonnello (s. 41) to idealne miejsce, aby smakowicie zakończyć wędrówkę szlakiem architektury barokowej i pobyt na Sycylii. Kup książkę 13 Poleć książkę Kup książkę Poleć książkę © silberkorn73 / Fotolia.comSycylijskie winniceZAPROSZENIE DO PODRÓŻY Kup książkę Poleć książkę ZAPROSZENIE DO PODRÓŻY Kup książkę Poleć książkę Tysiące kształtów i tysiące barwJeśli zieleń gór kontrastuje z oszałamiają-cym błękitem morza, opuncje porastają stoki narciarskie ogrzewane przez wulkan, a zimą migdałowce olśniewają bielą kwiatów, to nie ma wątpliwości, trafiliśmy na Sycylię!Następujące po sobie pory roku tworzą paletę fascynujących kolorów – od żółci janowców i mimoz, przez zieleń łąk i ochrę spalonej słońcem ziemi, po czerwień polnych maków i bugenwilli. Wiosną powietrze na tym wyjątkowym skrawku lądu wypełnia się zapachem kwiatów pomarańczy i janowców. Zmysły budzą się i gubią w zderzeniu z pięknem krajobrazu, który nieustannie zaskakuje, zmieniając się co kilka kilo-metrów, od wzniesień Etny po zatoki opasane wstęgami drobnego piasku. To tylko jedno oblicze Sycylii, a jest ich o wiele więcej, mniej znanych, ale zawsze zaskakujących.Wschodnie wybrzeżePoczątkowy odcinek wschodniego wybrzeża wyspy tworzy niska linia brzegowa z trzema dużymi zatokami: zatoką Noto, zatoką Augusta i rozległą Zatoką Katańską, która oplata brzeg przechodzący w największą nizinę na Sycylii. Krajobraz wybrzeża na północ od Katanii, aż do Mesyny, tworzą wyso-kie klify, u stóp których rozpościerają się malownicze zatoczki. Czarne skały wulkaniczne z Etny i wapienne ściany Gór Pelorytańskich (przedłużenie kalabryjskiej części Apeninów) tworzą okazałe klify i zachwycające panoramy, jak na wybrzeżu w okolicach Taorminy i Acireale.Drzewka cytrusowe, oliwne, figowe…Na wybrzeżu i nizinnych obszarach Sycy-lii, które charakteryzują się łagodnym klimatem, występuje typowa roślinność śródziemnomorska.Rośnie tu mirt, poziomkowce i pistacje kleiste. Janowce, które charakteryzują się pojedynczymi, zimozielonymi liśćmi, pod koniec wiosny zachwycają żółtymi kwiatami.Oprócz krzewów na Sycylii rosną olean-dry, które mają długie, zimozielone liście, RAJSKI ZAKĄTEK© Modestinus / Fotolia.comPanorama Taorminy54 Kup książkę Poleć książkę a wiosną i latem okrywają się białymi, różowymi lub żółtymi kwiatami, oraz drzewa karobowe (głównie w okolicach Ragusy) z charakterystycznymi brązo-wawymi strąkami. Można tu również znaleźć eukaliptusy z pachnącymi liśćmi o lancetowatym kształcie, z których uzyskuje się olejek o właściwościach odkażających; dzikie kolczaste drzewka oliwne (olivastri), które są wykorzysty-wane do szczepienia odmian upraw-nych; sosny nadmorskie, których długie i proste pnie są zakończone stożkowa-tymi koronami, a także sosny piniowe.Rozległe tereny są obsadzone winną latoroślą (zob. s. 69), drzewami oliwnymi o wykrzywionych pniach i srebrnozie-lonych koronach, a także drzewami cytrusowymi (cytryny, pomarańcze i mandarynki). Te ostatnie stanowią charakterystyczny element „ogrodu”, tym mianem określa się na Sycylii plantacje drzew cytrusowych, nie zaś tereny zie-lone o ozdobnej funkcji. Jałowe ziemie są porośnięte roślinami kolczastymi, takimi jak osty, a także plantacjami kar-łatek niskich.Jedną z zasadniczych cech sycylijskiego krajobrazu jest obecność wielu odmian roślin gruboszowatych, które nazywa się też sukulentami. Do ich grona zalicza się gigantyczne agawy, nieskończoną liczbę gatunków kaktusów i opuncje.Każdy region szczyci się występowa-niem miejscowej flory, np. cibora papi-rusowa rośnie wzdłuż brzegów rzeki Ciane, niedaleko Syrakuz (zob. s. 119).© leospata / Fotolia.comSycylijskie pomarańcze© vvoe / Fotolia.comOgród oliwny55Zaproszenie do podróży | Rajski zakątek Kup książkę Poleć książkę S. BERILLOPORTOVECHIOVia SantaFilomenaVia EtneaVia EtneaV.Crociferi3918125341587269210871S. GiulianoSanPlacidoVGDuomoS.MicheleArcangeloSan Nicolòl ArenaSant Agataal CarcereEAnfiteatroCollegiataBSanBiagioKSanFrancescoPiazzaVaccariniPiazzaVergaPiazza V.LanzaPiazzaRepubblicaPiazzadelleGuardiePiazzaMachavaliF2Pza SpiritoSantoPiazza deiMartiriPzaStesicoroPiazzaTrentoPzaBelliniPiazzaG. BovioF1Piazza CarloAlbertoPzaGrenoblePiazzaCutelliOrtoBotanicoVillaBelliniTeatro AnticoCasa diVergaNTeatroBelliniPalazzodelle PosteMuseoDiocesanoMonastero deiBenedettiniCastelloUrsinoMACSUHTermedell IndirizzoMPalazzoManganelliBiblioteche riuniteOdeonPal. S. DemetrioS4PalazzoBiscariCso. ItaliaV. SistoMoloCrispiMoloCrispiV. AsmaraV.DePretisV. PaciniV.SantissimaTrinitàV. VinciguerraV. FornaciaiV. BelfioreV.GiuseppeVerdiV.GiuseppeDiStefanoV. MonteVergineV. UghettiV. VelisV.BenedettoGuzzardiV. NicolaFabriziV. OrtolaniV.PtadiFerroV. CelesteV. FrancescoBattiatoV.MulinoaVentoV.FiorentinoV. QuartiereMilitareV.StaMariadelleSaletteV.ReclusoriodelLumeV.Sta BarbaraV.TrigonaV. GiuseppeSimiliV.VecchiaOgninaV. MurifabbroV. JuvaraV. AloiV.SalvatoreDiGiacomoV.ConsolazioneV.NaumachiaV.PietroToselliV.D AmicoV. VeronaV. Dottor ConsoliV.AbateFerraraV. ZuccarelliV.TorredelVescovoV. NinoMartoglioV. IpogeoV. Marchesedi CasalottoV. CosentinoV. MuscatelloV. RoccaromanaV.GramignaniV. SalvatorePaolaV. PapaleV. AsiloSant AgataV. FedericoCiccaglioneV. TestullaV. PietroMascagniV.MatteoRenatoImbrianiV. GuglielmoOberdanV. GiuseppeDe FeliceV. MusumeciV. CarmelitaniV. MorosoliV.ContediTorinoV. MusumeciV. ArchimedeV.GabrielloCarnazzaV. Stella PolareV.GrotteBiancheV. Luigi CapuanaV.GrimaldiV. Umberto IV. Enrico Adolfo PantanoV. CarondaV. CarondaV. FirenzeV.SalvatoreTomaselliV. EnricoFerriV.Sant EuplioV.CristoforoColomboV.GaribaldiV. MonsignoreVentimigliaV. GaribaldiV. GabrieleD AnnunzioV.S.NicolòalBorgoV. MonserratoVle Regina MargheritaV. AndroneV.LagodiNicitoVle 20 SettembreV.PlebiscitoV.PlebiscitoV.PlebiscitoV.PlaiaV.PlebiscitoCso. SiciliaV.MulinoStaLuciaV.CristoforoColomboGV_WE_fra0064c01w00_catania _95x136 CATCATCATCATCATCATCATCATCATCAT0150 m150 m150 m150 m150 mS. MARIA DI GESÙA 18, ACIREALEMESYNA,TAORMINALE CIMINIEREMESYNA, TAORMINAPALERMO, SYRAKUZYKATANIAGV_WE_fra0064c02w00_catane 95x48__(105x58)RESTAURACJEDa Nino . . . . . . . . . . . . . . . . . . . .¡FUD Bottega Sicula . . . . . . . . .ªLa Cucina dei Colori . . . . . . . .£Me Cumpari Turiddu . . . . . . .§Osteria Antica Marina . . . . . .©Sale Art Café . . . . . . . . . . . . . . .¢Sicilia in Bocca . . . . . . . . . . . . .U Fucularu . . . . . . . . . . . . . . . . .¥Wine bar Razmataz . . . . . . . . .¨BARY I KAWIARNIEEtnea Roof Una Hotel . . . . . .¡First . . . . . . . . . . . . . . . . . . . . . . .£I Dolci di Nonna Vincenza . .¤Prestipino Cafè . . . . . . . . . . . . .¢Savia . . . . . . . . . . . . . . . . . . . . . .¥Spinella . . . . . . . . . . . . . . . . . . . .¦ZAKUPYDagnino . . . . . . . . . . . . . . . . . . .§Enoteca di Sicilia . . . . . . . . . . .¨Siculamente . . . . . . . . . . . . . . .©ROZRYWKABar Cuore . . . . . . . . . . . . . . . . . .¡Bohème Mixology Bar . . . . . .¢Badia di Sant’Agata . . . . . . . BSan Benedetto . . . . . . . . . . . . EPza del Duomo . . . . . . . . . . . . F1Pza dell’Università . . . . . . . . F2San Francesco Borgia . . . . . GPalazzo Senatorioo degli Elefanti . . . . . . . . . . . HTarg rybny . . . . . . . . . . . . . . . . . KMuseo Belliniano, Museo Emilio Greco . . . . . . . MTerme Achilliane . . . . . . . . . . NPalazzo Sangiuliano. . . . . . S4Palazzo dell’Università. . . . U Terme della Rotonda/ Santa Maria della Rotonda . . . . . . . . . . . . V82 Kup książkę Poleć książkę domu w Puteaux i pierwotnie został pochowany w Paryżu.Transept zamykają dwie kaplice, do których można wejść, przechodząc pod renesansowymi łukami. Kaplica po prawej stronie, poświęcona Matce Bożej, kryje w swym wnętrzu sarkofag Konstancji, zmarłej w 1363 r. małżonki Fryderyka III Sycylijskiego. W prawej apsydzie znajduje się bogata w zło-cone zdobienia renesansowa kaplica św. Agaty. Misternie rzeźbiony portal prowadzi do relikwii i skarbca. Przy ścia-nie po lewej stronie jest umieszczony pomnik nagrobny wicekróla Fernanda de Acuñy (1495).W zakrystii (tel.: 339 48 59 942 – zwiedza-nie z przewodnikiem wt.–pt. 11.45, 16.15 i 17.00) można zobaczyć wielki fresk (niestety uszkodzony) ukazujący miasto przed 1669 r., uwiecznione na tle Etny szykującej się do wybuchu.Terme Achilliane (D4)Piazza del Duomo – pn., śr., pt. 9.00–14.00, wt., czw. 9.00–14.00, 15.00–18.00, sb. 9.00–13.00 – nieczynne w nd. – 5 EUR, 10 EUR bilet łączony ze zwiedzaniem Museo Diocesano (kasa biletowa w muzeum).Kierując się w dół, na prawo od portalu Duomo, docieramy do pozostałości term z II w., które były częścią sieci łaźni miejskich. W jej skład wchodziły również Terme dell’Indirizzo (C4-5) i Terme della Rotonda (zob. s. 88). Nazwa Achilliane pochodzi od odnalezionej w tym miejscu inskrypcji.Museo Diocesano (D4)Piazza del Duomo/via Etnea 8 – tel.: 095 28 16 35 – www.museodiocesanocatania.com – pn., śr., pt. 9.00–14.00, wt., czw. 9.00–14.00, 15.00–18.00, sb. 9.00–13.00 – nie-czynne w nd. – 7 EUR, 10 EUR bilet łączony ze zwiedzaniem Terme Achilliane.Zwiedzanie rozpoczyna się od tara-sów« (wjazd windą), z których można podziwiać piękny widok na katedrę, miasto i Porta Uzeda. W muzeum są pre-zentowane zbiory obrazów i zabytków rzemiosła artystycznego. Za kafeterią znajduje się sala poświęcona obchodom święta św. Agaty (zob. s. 84). Można tu podziwiać feretron (vara di Sant’Agata) wykorzystywany w czasie procesji do przenoszenia popiersia z relikwiami świętej.Fontana dell’Amenano (D4)Acqua a lenzuolo (dosłownie „woda w formie sukna”) – takim mianem mieszkańcy Katanii określają fontannę znajdującą się w południowej części piazza del Duomo, ponieważ woda spływająca z górnej misy przypomina zwisający woal. Fontanna jest zasilana wodą z cieku o tej samej nazwie, który przepływa w rejonie najważniejszych zabytków z epoki rzymskiej (starożyt-nego teatru i term Rotonda).Targ rybny« (D4)Za fontanną rozciąga się piazza Alonzo di Benedetto, na którym codziennie rano (w godzinach 6.00–13.30 z wyjątkiem nd.) odbywa się malowniczy targ ciągnący się aż do hali targowej w dawnej korde-gardzie bramy Karola V. Brama stanowiła część XVI-wiecznych fortyfikacji, z piazza Pardo nadal widać jej fasadę. Idąc wzdłuż ściany Palazzo dei Chierici, który wznosi się przy piazza di Benedetto, można zobaczyć Fontana dei Sette Canali.© SG- design / Fotolia.comTarg rybnyKatania, Taormina i Syrakuzy | Katania83 KATANIA, SYRAKUZY I TAORMINA Mediolan Turyn Bolonia Genua Wenecja Florencja Rzym SARDYNIA Neapol WŁOCHY SYCYLIA TAORMINA KATANIA SYRAKUZY Ruszaj w świat z przewodnikiem Michelin! • poręczny format • czytelny układ treści • fascynujące portrety miast • liczne ciekawostki • aktualne informacje praktyczne Michelin zaprasza Cię do wspólnego odkrywania najpiękniejszych zakątków Katanii, Syrakuz i Taorminy. Z  tym przewodnikiem zwiedzanie będzie prawdziwą przyjemnością! Szukasz niezwykłych miejsc i  intrygujących zabytków? Nic prostszego! Dzięki gwiazdkom przy nazwach obiektów, dzielnic i  miejscowości nie pominiesz żadnej turystycznej atrakcji. Szczegółowe plany i trasy zwiedzania ułatwią poruszanie się po miastach i ich okolicach. Starannie dobrane propozycje miejsc pomogą Ci znaleźć niebanalny nocleg, restaurację czy kawiarnię, w  których spędzisz wyjątkowe chwile. Gwiazdki – tradycyjny system oceny atrakcji turystycznych:  zobacz koniecznie  warto odwiedzić  godne uwagi Księgarnia internetowa: http://bezdroza.pl Zamówienia telefoniczne: tel.: 0 801 339900 kom.: 0 601 339900 ISBN 978-83-283-4334-4 ISBN 978-83-283-4334-4 9 788328 343344 Zaplanuj trasę podróży z serwisem www.ViaMichelin.com Cena 20,90 zł
Pobierz darmowy fragment (pdf)

Gdzie kupić całą publikację:

Katania, Syrakuzy i Taormina. Michelin. Wydanie 1
Autor:

Opinie na temat publikacji:


Inne popularne pozycje z tej kategorii:


Czytaj również:


Prowadzisz stronę lub blog? Wstaw link do fragmentu tej książki i współpracuj z Cyfroteką: